-
Purpose3rd generation lenti vector encoding dCas9-VP64 with 2A puromycin resistance marker (EF1a-dCas9-VP64-T2A-Puro-WPRE)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99371 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLenti
- Backbone size w/o insert (bp) 9192
- Total vector size (bp) 14292
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin, Zeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-VP64-T2A-Puro
-
SpeciesSynthetic; S. pyogenes
-
Insert Size (bp)5100
- Promoter EF-1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTTGGATCTTGGTTCATTCTCAAGCCTCAG
- 3′ sequencing primer cacatagcgtaaaaggagcaacatag (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bydCas9-VP64: Addgene plasmid #61425 (Feng Zhang lab)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The backbone plasmid and dCas9-VP64 sequence are from Addgene plasmid #61425 (generously shared by Feng Zhang lab). "Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex.", Konermann et al.. 2014
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti-EF1a-dCas9-VP64-Puro was a gift from Kristen Brennand (Addgene plasmid # 99371 ; http://n2t.net/addgene:99371 ; RRID:Addgene_99371) -
For your References section:
Evaluating Synthetic Activation and Repression of Neuropsychiatric-Related Genes in hiPSC-Derived NPCs, Neurons, and Astrocytes. Ho SM, Hartley BJ, Flaherty E, Rajarajan P, Abdelaal R, Obiorah I, Barretto N, Muhammad H, Phatnani HP, Akbarian S, Brennand KJ. Stem Cell Reports. 2017 Aug 8;9(2):615-628. doi: 10.1016/j.stemcr.2017.06.012. Epub 2017 Jul 27. 10.1016/j.stemcr.2017.06.012 PubMed 28757163