pUC19-Cv3
(Plasmid
#99351)
-
PurposeSynthetic sequence for single-stranded DNA production
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99351 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUC19
-
Backbone manufacturerNew England Biolabs
- Backbone size w/o insert (bp) 2692
- Total vector size (bp) 3779
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLine from The Crucible Act 3
-
Alt nameCv3
-
Insert Size (bp)1087
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer GTGCTGCAAGGCGATTAAGTTGG
- 3′ sequencing primer CGCAATTAATGTGAGTTAGCTCAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19-Cv3 was a gift from Mark Bathe (Addgene plasmid # 99351 ; http://n2t.net/addgene:99351 ; RRID:Addgene_99351) -
For your References section:
In vitro synthesis of gene-length single-stranded DNA. Veneziano R, Shepherd TR, Ratanalert S, Bellou L, Tao C, Bathe M. Sci Rep. 2018 Apr 25;8(1):6548. doi: 10.1038/s41598-018-24677-5. 10.1038/s41598-018-24677-5 PubMed 29695837