Skip to main content
Addgene

His-MBP-NRBF2 (1-159)
(Plasmid #99331)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99331 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    1M
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Nuclear receptor-binding factor 2
  • Alt name
    NRBF2
  • Species
    H. sapiens (human)
  • Mutation
    AA1-159 are present
  • GenBank ID
    NP_110386.2
  • Entrez Gene
    NRBF2 (a.k.a. COPR, COPR1, COPR2, NRBF-2)
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis-MBP-TEV (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer MBP_1010F: 5�- ccgctttctggtatgccgtgcg
  • 3′ sequencing primer T7-Term
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid contains His-MBP-TEVsite-NRBF2 (1-159).

IMPORT NOTES: Special character found in field(5-prime Sequencing Primer)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    His-MBP-NRBF2 (1-159) was a gift from James Hurley (Addgene plasmid # 99331 ; http://n2t.net/addgene:99331 ; RRID:Addgene_99331)

  • For your References section:

    Dynamics and architecture of the NRBF2-containing phosphatidylinositol 3-kinase complex I of autophagy. Young LN, Cho K, Lawrence R, Zoncu R, Hurley JH. Proc Natl Acad Sci U S A. 2016 Jul 19;113(29):8224-9. doi: 10.1073/pnas.1603650113. Epub 2016 Jul 6. 10.1073/pnas.1603650113 PubMed 27385829
Related items:
Commonly requested with: