Skip to main content
Addgene

pLEXm-GST-ATG14
(Plasmid #99329)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99329 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLEXm
  • Backbone manufacturer
    Jones lab (University of Oxford)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATG14
  • Species
    H. sapiens (human)
  • Mutation
    Codon optimized
  • GenBank ID
    NP_055739.2
  • Entrez Gene
    ATG14 (a.k.a. ATG14L, BARKOR, KIAA0831)
  • Promoter CMV
  • Tag / Fusion Protein
    • GST-TEV tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer pLEXm_fwd 5'- aacgtgctggttgttgtgctg -3'
  • 3′ sequencing primer pLEXm_rev 5’- accagccaccaccttctgata -3’
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid contains GST-TEVsite-ATG14-stop. ATG14 is codon-optimized.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLEXm-GST-ATG14 was a gift from James Hurley (Addgene plasmid # 99329 ; http://n2t.net/addgene:99329 ; RRID:Addgene_99329)

  • For your References section:

    Architecture and dynamics of the autophagic phosphatidylinositol 3-kinase complex. Baskaran S, Carlson LA, Stjepanovic G, Young LN, Kim DJ, Grob P, Stanley RE, Nogales E, Hurley JH. Elife. 2014 Dec 9;3. doi: 10.7554/eLife.05115. 10.7554/eLife.05115 PubMed 25490155
Related items:
Commonly requested with: