Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAG-OSF-VPS15
(Plasmid #99326)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99326 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAG
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VPS15
  • Species
    H. sapiens (human)
  • GenBank ID
    AAI27106.1
  • Entrez Gene
    PIK3R4 (a.k.a. VPS15, p150)
  • Promoter CMV
  • Tag / Fusion Protein
    • Strep-Strep-Flag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer pCAG_fwd: 5'- TTC CTCGATCGACGGTATCGA
  • 3′ sequencing primer pCAG_rev: 5'- gagccagggcattggccacac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Strep-Strep-Flag-VPS15-stop, codon-optimized gene

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-OSF-VPS15 was a gift from James Hurley (Addgene plasmid # 99326 ; http://n2t.net/addgene:99326 ; RRID:Addgene_99326)
  • For your References section:

    Architecture and dynamics of the autophagic phosphatidylinositol 3-kinase complex. Baskaran S, Carlson LA, Stjepanovic G, Young LN, Kim DJ, Grob P, Stanley RE, Nogales E, Hurley JH. Elife. 2014 Dec 9;3. doi: 10.7554/eLife.05115. 10.7554/eLife.05115 PubMed 25490155