pCS2+ H2B-TagRFP-T
(Plasmid #99271)

• Purpose: Contains a fusion of human histone H2B to fluorescent protein TagRFP-T in the pCS2+ expression vector. It has the SP6 RNA polymerase site for in vitro transcription.
• Depositing Lab: Philipp Keller
• Publication: Dr. Philipp Keller Lab (unpublished)

Backbone

• Vector backbone: pCS2+
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TagRFP-T
• Insert Size (bp): 732
• Promoter: SP6
• Tag / Fusion Protein:
  • H2B (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: Xbal (not destroyed)
• 5′ sequencing primer: CGATTTAGGTGACACTATAG
• 3′ sequencing primer: TAATACGACTCACTATAGG

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: There is an N122D mutation in TagRFP in this plasmid. The depositor has confirmed this will not affect the plasmid function.