pINDUCER22-MKK6E-Flag
(Plasmid #99259)

• Purpose: Lentiviral vector encoding a doxycycline-inducible Flag-tagged constitutively active MKK6.
• Depositing Labs: Alejandro Adam, Peter Vincent
• Publication: Adam et al PLoS One. 2016 Sep 7;11(9):e0161975. doi: 10.1371/journal.pone.0161975. eCollection 2016.

Backbone

• Vector backbone: pINDUCER/22
• Backbone manufacturer: Dr. Thomas Westbrook, Baylor College of Medicine
• Backbone size w/o insert (bp): 10437
• Total vector size (bp): 11487
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: MKK6E
• Alt name: Dual specificity mitogen-activated protein kinase kinase 6 (active)
• Alt name: MKK6(glu)
• Species: H. sapiens (human)
• Insert Size (bp): 1050
• Mutation: S207E T211E
• GenBank ID: U39656 NM_002758.3
• Entrez Gene: MAP2K6 (a.k.a. MAPKK6, MEK6, MKK6, PRKMK6, SAPKK-3, SAPKK3)
• Promoter: TRE2
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: GTTTGTACAAAAAAGCAGGC
• 3′ sequencing primer: CCACTTTGTACAAGAAAGCTGGGT

Resource Information

• Supplemental Documents:
  • MKK6E FLAG pINDUCER22.gbk
• A portion of this plasmid was derived from a plasmid made by: MKK6E was from Addgene plasmid #13518. pINDUCER/22 vector was from Dr. Thomas Westbrook, Baylor College of Medicine: Meerbrey KL, Hu G, Kessler JD, Roarty K, Li MZ, Fang JE, et al. The pINDUCER lentiviral toolkit for inducible RNA interference in vitro and in vivo. Proceedings of the National Academy of Sciences of the United States of America. 2011;108(9):3665–70. Epub 2011/02/11. pmid:21307310; PubMed Central PMCID: PMC3048138.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Contains an IRES-GFP insert