pGLACTE-PseudoHT51
(Plasmid #99257)

• Purpose: Contains expanded CGG repeats (98 repeats with 2 AGG interruptions) within the 5'UTR of FMR1. Internal control with synthetic primer sequence for capillary electrophoresis
• Depositing Lab: Karen Usdin
• Publication: Hayward et al J Mol Diagn. 2017 Nov;19(6):828-835. doi: 10.1016/j.jmoldx.2017.06.008. Epub 2017 Aug 14.

Backbone

• Vector backbone: pGL3
• Total vector size (bp): 4353

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: FMR1
• Species: H. sapiens (human), Synthetic
• Mutation: Contains synthetic, non-human, primer sequence downstream of CGG repeats
• Entrez Gene: FMR1 (a.k.a. FMRP, FRAXA, POF, POF1)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: gttgctaatgcgcgtaggat
• 3′ sequencing primer: ggcacctgtcctacgagttg

Resource Information

• Supplemental Documents:
  • SnapGene annotation file
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

CGG repeats are moderately unstable in prolonged bacterial culture at 37C. Upon receipt select several colonies and grow overnight. Immediately make glycerol stocks and verify the insert size. Inoculate directly from glycerol and grow for ~10 hours for large scale preparations.