pAAV-CAG-Chronos-GFP
(Plasmid #99232)

• Purpose: AAV-mediated expression of Chronos-GFP under the CAG promoter. Using bGHpA signal.
• Depositing Lab: Edward Boyden
• Publication: Klapoetke et al Nat Methods. 2014 Mar;11(3):338-46. doi: 10.1038/nmeth.2836. Epub 2014 Feb 9.

Backbone

• Vector backbone: AAV with CAG promter
• Backbone manufacturer: Epoch
• Backbone size w/o insert (bp): 4662
• Total vector size (bp): 6372
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Can use Stbl3 at 30°C or DH5alpha at 37°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Chronos-GFP
• Alt name: Stigeoclonium helveticum channelrhodopsin-GFP
• Alt name: ChR90-GFP
• Species: Stigeoclonium helveticum
• Insert Size (bp): 1710
• GenBank ID: KF992040
• Promoter: CAG
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRV (not destroyed)
• 5′ sequencing primer: gtgaccggcggctctagagc
• 3′ sequencing primer: cattaaagcagcgtatccac

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid is fully sequenced in the coding sequence regions (fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.