pAAV-CaMKII-ChrimsonR-tdTomato
(Plasmid #99231)

• Purpose: AAV-mediated expression of ChrimsonR-tdTomato under the CaMKII promoter. tdTomato has codons varied between the first and second tandem repeats to reduce recombination. Using SV40 signal.
• Depositing Lab: Edward Boyden
• Publication: Klapoetke et al Nat Methods. 2014 Mar;11(3):338-46. doi: 10.1038/nmeth.2836. Epub 2014 Feb 9.

Backbone

• Vector backbone: AAV-CaMKII
• Backbone manufacturer: Scott Sternson (original AAV-CAG)
• Backbone size w/o insert (bp): 5088
• Total vector size (bp): 7584
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Can use Stbl3 at 30°C or DH5alpha at 37°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: ChrimsonR-tdTomato
• Alt name: Chrimson K176R mutant- tdTomato
• Alt name: ChR88m19-tdTomato
• Alt name: Chlamydomonas noctigama channelrhodopsin K176R mutant-tdTomato
• Species: Chlamydomonas noctigama
• Insert Size (bp): 2496
• Mutation: Chrimson K176R mutant
• GenBank ID: KF992060
• Promoter: CaMKII
• Tag / Fusion Protein:
  • tdTomato (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TCTCCATTTGCACTCAGG
• 3′ sequencing primer: cattaaagcagcgtatccac

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid is fully sequenced in the coding sequence regions (fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.

In addition, the published CaMKII promoter contains 10 basepair differences vs. the wild-type, and that persists here.