Ensconsin-18-mEos2
(Plasmid #99230)

• Purpose: Mammalian expression of the photoconvertible protein mEos2 as an Ensconsin fusion.
• Depositing Lab: Periklis Pantazis
• Publication: Mohr et al Angew Chem Int Ed Engl. 2017 Jun 29. doi: 10.1002/anie.201706121.

Backbone

• Vector backbone: pCMV
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mEos2
• Species: Synthetic
• Insert Size (bp): 681
• Promoter: CMV
• Tag / Fusion Protein:
  • Ensconsin (MAP7) (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: atggtgttcagacacagc
• 3′ sequencing primer: CAAATGTGGTATGGCTGATT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry