Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Ensconsin-18-mEos2
(Plasmid #99230)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99230 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mEos2
  • Species
    Synthetic
  • Insert Size (bp)
    681
  • Promoter CMV
  • Tag / Fusion Protein
    • Ensconsin (MAP7) (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer atggtgttcagacacagc
  • 3′ sequencing primer CAAATGTGGTATGGCTGATT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Ensconsin-18-mEos2 was a gift from Periklis Pantazis (Addgene plasmid # 99230 ; http://n2t.net/addgene:99230 ; RRID:Addgene_99230)
  • For your References section:

    Rational Engineering of Photoconvertible Fluorescent Proteins for Dual-Color Fluorescence Nanoscopy Enabled by a Triplet-State Mechanism of Primed Conversion. Mohr MA, Kobitski AY, Sabater LR, Nienhaus K, Obara CJ, Lippincott-Schwartz J, Nienhaus GU, Pantazis P. Angew Chem Int Ed Engl. 2017 Jun 29. doi: 10.1002/anie.201706121. 10.1002/anie.201706121 PubMed 28661566