Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCMV-Lifect-7-pr-mEos2 (mEos2-A69T)
(Plasmid #99229)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99229 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 4012
  • Total vector size (bp) 4793
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    pr-mEos2
  • Alt name
    prmEos2, mEos2-A69T
  • Species
    Synthetic
  • Insert Size (bp)
    681
  • Mutation
    A69T for primed conversion applications
  • Promoter CMV
  • Tag / Fusion Protein
    • Lifeact (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-Lifect-7-pr-mEos2 (mEos2-A69T) was a gift from Periklis Pantazis (Addgene plasmid # 99229 ; http://n2t.net/addgene:99229 ; RRID:Addgene_99229)
  • For your References section:

    Rational Engineering of Photoconvertible Fluorescent Proteins for Dual-Color Fluorescence Nanoscopy Enabled by a Triplet-State Mechanism of Primed Conversion. Mohr MA, Kobitski AY, Sabater LR, Nienhaus K, Obara CJ, Lippincott-Schwartz J, Nienhaus GU, Pantazis P. Angew Chem Int Ed Engl. 2017 Jun 29. doi: 10.1002/anie.201706121. 10.1002/anie.201706121 PubMed 28661566