Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLXRN-EGFP
(Plasmid #99207)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99207 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLXSN
  • Backbone manufacturer
    Dr. Dusty Miller, Fred Hutchinson Cancer Center, Seattle, WA
  • Modifications to backbone
    The SV40 promoter driving Neomycin selection marker was replaced with an internal ribosome entry site/sequence (IRES) from encephalomyocarditis virus to generate the bicistronic retroviral vector
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Can be propagated in E. coli DH5alpha. E. coli SURE or E. coli STBL recommended for minimizing recombination events
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Alt name
    Enhanced green fluorescent protein
  • Species
    Synthetic; Aequorea victoria
  • Insert Size (bp)
    715
  • Mutation
    A Kozak sequence was incorporated to enhance translational efficiency
  • GenBank ID
    U55762
  • Promoter LTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer CCTCACATTGCCAAAAGACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    EGFP was PCR amplified off plasmid vector EGFP-N1 (GenBank acc. no. U55762)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

When transfected into packaging cell lines PE501 (ecotropic) or PA317 (amphotropic) the plasmid will generate live retrovirus. Thus, under these conditions BSL2 safety will need to be observed.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLXRN-EGFP was a gift from Peter Pedersen (Addgene plasmid # 99207 ; http://n2t.net/addgene:99207 ; RRID:Addgene_99207)