pLXRN
(Plasmid #99206)

• Purpose: (Empty Backbone) Bicistronic retroviral vector
• Depositing Lab: Peter Pedersen
• Publication: pLXRN bicistronic retroviral vector (unpublished)

Backbone

• Vector backbone: pLXSN
• Backbone manufacturer: Dr. Dusty Miller, Fred Hutchinson Cancer Center, Seattle, WA
• Modifications to backbone: The SV40 promoter driving Neomycin selection marker was replaced with an internal ribosome entry site/sequence (IRES) from encephalomyocarditis virus to generate the bicistronic retroviral vector
• Vector type: Mammalian Expression, Retroviral
• Promoter: LTR
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: can be propagated in E. coli DH5alpha. However, above strains are recommended to minimize recombination events.
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: CCCTTGAACCTCCTCGTTCGACC
• 3′ sequencing primer: GTAAAGCATGTGCACCGAGGCC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Neomycin marker is already in the parental vector pLXSN

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

When transfected into packaging cell lines PE501 (ecotropic) or PA317 (amphotropic) the vector will generate live retrovirus. Thus, under these conditions BSL2 level safety will be required.