pLXIN2-EGFP
(Plasmid #99204)

• Purpose: EGFP expressing bicistronic retroviral vector
• Depositing Lab: Saroj Mathupala
• Publication: pLXIN2 (unpublished)

Backbone

• Vector backbone: pLXIN2
• Backbone manufacturer: Mathupala, S.P.
• Backbone size w/o insert (bp): 6059
• Total vector size (bp): 6780
• Modifications to backbone: EGFP (enhanced green fluorecent protein) cDNA was inserted between EcoRI and XhoI sites of the MCS in vector.
• Vector type: Mammalian Expression, Retroviral ; Bicistronic retroviral expression vector
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Can be propagated in E. coli DH5alpha if necessary. However, for maintenance it is best to propagate in recombination deficient strains such as SURE or STBL.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP
• Alt name: enhanced green fluorescent protein
• Species: Synthetic; Aequorea victoria
• Insert Size (bp): 721
• Mutation: A Kozak sequence was inserted 5' to ATG to enhance translation efficiency. EGFP was PCR amplified off EGFP-N1 vector (GenBank #U55762).
• GenBank ID: U55762 U55762

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CCCTTGAACCTCCTCGTTCGACC
• 3′ sequencing primer: GTGCAATCCATCTTGTTCAATGGC

Resource Information

• Supplemental Documents:
  • Microscopy images

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

When transfected into amphotropic (PA317) or ecotropic (PE501) mammalian packaging cell lines, the plasmid pLXIN2 will generate live retrovirus. Thus, the procedures will require handling at BSL2 level, when the plasmid is used to generate recombinant retrovirus for transduction.

Please note the Kozak sequence is missing a nucleotide; however, this has no functional consequence for expression.