pLXIN2
(Plasmid #99203)

• Purpose: (Empty Backbone) Bicistronic retroviral vector (optimized internal ribosome entry site)
• Depositing Lab: Saroj Mathupala
• Publication: pLXIN2 (unpublished)

Backbone

• Vector backbone: pLXSN
• Backbone manufacturer: Miller, A.D., GenBank Acc. No. M28248
• Backbone size (bp): 5874
• Modifications to backbone: Internal SV40 promoter driving Neomycin (Geneticin; G-418) selection of pLXSN was replaced with IRES (internal ribosome entry site/sequence) from EMCV (encephalomyocarditis virus; GenBank NC_001479) to generate this bicistronic retroviral vector. The IRES was kept unaltered, and the translation initiation of neomycin phosphotransferase occurs at the 11th ATG of the IRES, identical to that of the wild type virus. Most commercial plasmid and retroviral vectors harbor an IRES where the 11th ATG is missing. Translation initiation begins 19 bp downstream off a synthetic ATG codon. The original MCS of pLXSN, EcoRI-HpaI-XhoI-BamHI was maintained unaltered.
• Vector type: Mammalian Expression, Retroviral
• Promoter: LTR
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: CCCTTGAACCTCCTCGTTCGACC
• 3′ sequencing primer: GTGCAATCCATCTTGTTCAATGGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The original pLXSN vector was obtained from Dr. Dusty Miller at Fred Hutchinson Cancer Center in Seattle, WA.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

When transfected into amphotropic (PA317) or ecotropic (PE501) mammalian packaging cell lines, the plasmid pLXIN2 will generate live retrovirus. Thus, the procedures will require handling at BSL2 level, when the plasmid is used to generate recombinant retrovirus for transduction.