pCW57.1-Tet-UPF1WT (pRKB264)
(Plasmid #99146)

• Purpose: Inducible lentiviral construct to express FLAG-tagged UPF1wt
• Depositing Lab: Robert Bradley
• Publication: Feng et al Mol Cell. 2017 Jul 20;67(2):239-251.e6. doi: 10.1016/j.molcel.2017.05.034. Epub 2017 Jun 29.

Backbone

• Vector backbone: pCW57.1
• Backbone manufacturer: Addgene plasmid #41393
• Backbone size w/o insert (bp): 7600
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: UPF1
• Alt name: UPF1, RNA helicase and ATPase
• Species: H. sapiens (human)
• Insert Size (bp): 3400
• Mutation: First 127 codons are optimized to reduce GC content
• Entrez Gene: UPF1 (a.k.a. HUPF1, NORF1, RENT1, UTF, pNORF1, smg-2)
• Promoter: pTight
• Tag / Fusion Protein:
  • Flag (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: GTCAGATCGCCTGGAGAATT
• 3′ sequencing primer: CTAGTGAGACGTGCGGCTTC

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A UPF1 sequence-verified cDNA clone was ordered from Dharmacon (clone ID 5555509). The UPF1 cDNA was then amplified and cloned into the Dox-inducible lentiviral vector pCW57.1 (Addgene #41393) using the Gibson Assembly Cloning Kit (NEB). Due to high GC content within the first 500 bp of UPF1 cDNA, several attempts to introduce an N-terminal FLAG-tag via PCR primer overhangs failed. The FLAG-tag sequence was therefore introduced after the ATG start codon by replacing the first 381 bp of the UPF1 coding sequence with an in-frame, codon-optimized (lower GC content) gBlock DNA fragment containing the FLAG-tag (IDT).