pUB6-CDC34-HA (pRKB261)
(Plasmid #99145)

• Purpose: Mammalian expression construct to express HA-tagged CDC34
• Depositing Lab: Robert Bradley
• Publication: Feng et al Mol Cell. 2017 Jul 20;67(2):239-251.e6. doi: 10.1016/j.molcel.2017.05.034. Epub 2017 Jun 29.

Backbone

• Vector backbone: pUB6/V5-His A
• Backbone manufacturer: Thermo Fisher Scientific
• Backbone size w/o insert (bp): 5500
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CDC34
• Alt name: cell division cycle 34
• Species: H. sapiens (human)
• Insert Size (bp): 1500
• GenBank ID: NM_004359.1 NP_004350.1
• Entrez Gene: CDC34 (a.k.a. E2-CDC34, UBC3, UBCH3, UBE2R1)
• Promoter: pTight
• Tag / Fusion Protein:
  • HA (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: XhoI (unknown if destroyed)
• 5′ sequencing primer: TCAGTGTTAGACTAGTAAATTG
• 3′ sequencing primer: TAGAAGGCACAGTCGAGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A CDC34 sequence-verified cDNA clone was ordered from Dharmacon (clone ID 4103120). The CDC34 cDNA was cut out with restriction enzymes EcoRI/XhoI (NEB) and cloned into the mammalian expression vector pUB6/V5-His A (Thermo Fisher Scientific) via ligation. A C-terminal HA-tag was introduced via PCR primer overhangs to generate the pUB6-CDC34-HA construct for transfection.