-
PurposeExpresses Cas9 via the chicken beta actin promoter for electroporation in chicken embryos
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99138 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCI
- Total vector size (bp) 9036
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehumanized Cas9
-
Alt namehCas9
-
Insert Size (bp)4166
- Promoter Chicken beta actin (CAG)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CTCGAGAGTTCGAAGCCTTA
- 3′ sequencing primer gccaccaccttctgataggc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAGG>nls-hCas9-nls was a gift from Marianne Bronner (Addgene plasmid # 99138 ; http://n2t.net/addgene:99138 ; RRID:Addgene_99138) -
For your References section:
Optimization of CRISPR/Cas9 genome editing for loss-of-function in the early chick embryo. Gandhi S, Piacentino ML, Vieceli FM, Bronner ME. Dev Biol. 2017 Dec 1;432(1):86-97. doi: 10.1016/j.ydbio.2017.08.036. 10.1016/j.ydbio.2017.08.036 PubMed 29150011