Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMVS142_pACT1_mCherry_Zif268_EBD_MCS_KAN
(Plasmid #99049)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 99049 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFA6
  • Backbone size w/o insert (bp) 4149
  • Total vector size (bp) 7042
  • Vector type
    Yeast Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    ACT1 promoter
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    988
  • Entrez Gene
    ACT1 (a.k.a. YFL039C, ABY1, END7)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    705

Cloning Information for Gene/Insert 2

Gene/Insert 3

  • Gene/Insert name
    Zif268 DNA binding Domain
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    261
  • GenBank ID
    1AAY_A COG5048

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATGGCCATCATCAAGGAGTT
  • 3′ sequencing primer CAGGAGTGATGAACGCAAGA
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    Estrogen response domain
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    885
  • Entrez Gene
    ESR1 (a.k.a. ER, ESR, ESRA, ESTRR, Era, NR3A1)

Cloning Information for Gene/Insert 4

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TACCCGCCCATATGCTTG
  • 3′ sequencing primer tgaagtagagcccgcagt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMVS142_pACT1_mCherry_Zif268_EBD_MCS_KAN was a gift from Barak Cohen (Addgene plasmid # 99049 ; http://n2t.net/addgene:99049 ; RRID:Addgene_99049)
  • For your References section:

    A High-Throughput Mutational Scan of an Intrinsically Disordered Acidic Transcriptional Activation Domain. Staller MV, Holehouse AS, Swain-Lenz D, Das RK, Pappu RV, Cohen BA. Cell Syst. 2018 Mar 1. pii: S2405-4712(18)30052-8. doi: 10.1016/j.cels.2018.01.015. 10.1016/j.cels.2018.01.015 PubMed 29525204