pJB007
(Plasmid
#98995)
-
PurposeExpress FtsI tagged with tagRFP-t in E coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 98995 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCA24N
-
Backbone manufacturerNBRP-E.coli at NIG
-
Modifications to backbonereplaced N-terminal 6xHis with novel SpeI site, results in 6bp reduced expression
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor fluorescence studies, grow at RT or 30C.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFtsI
-
SpeciesE. coli
-
Insert Size (bp)1764
- Promoter T5-lac
-
Tag
/ Fusion Protein
- TagRFP-T (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ctttcgtcttcacctcgagaaatc
- 3′ sequencing primer gctaattaagcttggctgcaggt (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJB007 was a gift from Jie Xiao (Addgene plasmid # 98995 ; http://n2t.net/addgene:98995 ; RRID:Addgene_98995) -
For your References section:
GTPase activity-coupled treadmilling of the bacterial tubulin FtsZ organizes septal cell wall synthesis. Yang X, Lyu Z, Miguel A, McQuillen R, Huang KC, Xiao J. Science. 2017 Feb 17;355(6326):744-747. doi: 10.1126/science.aak9995. 10.1126/science.aak9995 PubMed 28209899