Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRM006
(Plasmid #98922)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 98922 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTB146
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FtsZ
  • Species
    E. coli
  • Insert Size (bp)
    1764
  • Promoter T7
  • Tag / Fusion Protein
    • Histag-SUMO (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TTTGTTTAACTTTAAGAAGGAG
  • 3′ sequencing primer AACTCAGCTTCCTTTCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRM006 was a gift from Jie Xiao (Addgene plasmid # 98922 ; http://n2t.net/addgene:98922 ; RRID:Addgene_98922)
  • For your References section:

    GTPase activity-coupled treadmilling of the bacterial tubulin FtsZ organizes septal cell wall synthesis. Yang X, Lyu Z, Miguel A, McQuillen R, Huang KC, Xiao J. Science. 2017 Feb 17;355(6326):744-747. doi: 10.1126/science.aak9995. 10.1126/science.aak9995 PubMed 28209899
Commonly requested with: