pJB089
(Plasmid #98914)

• Purpose: Express Dronpa tagged ZapA and pAmCherry1 tagged FtsZ in E coli
• Depositing Lab: Jie Xiao
• Publication: Buss et al PLoS Genet. 2015 Apr 7;11(4):e1005128. doi: 10.1371/journal.pgen.1005128. eCollection 2015 Apr.

Backbone

• Vector backbone: pCA24N
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: FtsZ
• Species: E. coli
• Insert Size (bp): 1149
• GenBank ID: NC_000913.3
• Promoter: T5-lac
• Tag / Fusion Protein:
  • pAmCherry1 (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: AAGCGCATTCTGAGCTGCC
• 3′ sequencing primer: gctaattaagcttggctgcaggt

Gene/Insert 2

• Gene/Insert name: ZapA
• Species: E. coli
• Insert Size (bp): 327
• GenBank ID: NC_000913.3
• Promoter: T5-lac
• Tag / Fusion Protein:
  • Dronpa (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ctttcgtcttcacctcgagaaatc
• 3′ sequencing primer: CTTTAATCACCGCGTCATTGG

Resource Information

• Supplemental Documents:
  • pJB089.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry