pJB057
(Plasmid #98911)

• Purpose: Express Dronpa tagged ZapA in E coli
• Depositing Lab: Jie Xiao
• Publication: Buss et al PLoS Genet. 2015 Apr 7;11(4):e1005128. doi: 10.1371/journal.pgen.1005128. eCollection 2015 Apr.

Backbone

• Vector backbone: pCA24N
• Backbone manufacturer: NBRP-E.coli at NIG
• Backbone size w/o insert (bp): 4500
• Total vector size (bp): 5400
• Modifications to backbone: replaced N-terminal 6xHis with novel SpeI site, results in 6bp reduced expression
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: For fluorescence studies, grow at RT or 30C.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ZapA
• Species: E. coli
• Insert Size (bp): 1040
• Promoter: T5-lac
• Tag / Fusion Protein:
  • Dronpa (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: ctttcgtcttcacctcgagaaatc
• 3′ sequencing primer: gctaattaagcttggctgcaggt

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry