Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pARiBo4
(Plasmid #98893)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98893 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTZ19R
  • Backbone manufacturer
    Fisher Scientific
  • Backbone size w/o insert (bp) 2790
  • Total vector size (bp) 2959
  • Modifications to backbone
    The T7 promotor was removed from the pTZ19R vector backbone but included in the vector insert.
  • Vector type
    in vitro transcription vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ARiBo4
  • Species
    Synthetic
  • Insert Size (bp)
    169
  • Promoter T7 promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TCACACAGGAAACAGCTATGACCA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pARiBo4 was a gift from Pascale Legault (Addgene plasmid # 98893 ; http://n2t.net/addgene:98893 ; RRID:Addgene_98893)
  • For your References section:

    Affinity purification of T7 RNA transcripts with homogeneous ends using ARiBo and CRISPR tags. Salvail-Lacoste A, Di Tomasso G, Piette BL, Legault P. RNA. 2013 Jul;19(7):1003-14. doi: 10.1261/rna.037432.112. Epub 2013 May 8. 10.1261/rna.037432.112 PubMed 23657939