pARiBo4
(Plasmid
#98893)
-
PurposeExpresses ARiBo-fused RNA in vitro with T7 RNA polymerase
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 98893 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepTZ19R
-
Backbone manufacturerFisher Scientific
- Backbone size w/o insert (bp) 2790
- Total vector size (bp) 2959
-
Modifications to backboneThe T7 promotor was removed from the pTZ19R vector backbone but included in the vector insert.
-
Vector typein vitro transcription vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameARiBo4
-
SpeciesSynthetic
-
Insert Size (bp)169
- Promoter T7 promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TCACACAGGAAACAGCTATGACCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pARiBo4 was a gift from Pascale Legault (Addgene plasmid # 98893 ; http://n2t.net/addgene:98893 ; RRID:Addgene_98893) -
For your References section:
Affinity purification of T7 RNA transcripts with homogeneous ends using ARiBo and CRISPR tags. Salvail-Lacoste A, Di Tomasso G, Piette BL, Legault P. RNA. 2013 Jul;19(7):1003-14. doi: 10.1261/rna.037432.112. Epub 2013 May 8. 10.1261/rna.037432.112 PubMed 23657939