pARiBo1
(Plasmid #98892)

• Purpose: Expresses ARiBo-fused RNA in vitro with T7 RNA polymerase
• Depositing Lab: Pascale Legault
• Publication: Di Tomasso et al Nucleic Acids Res. 2011 Feb;39(3):e18. doi: 10.1093/nar/gkq1084. Epub 2010 Nov 11.

Backbone

• Vector backbone: pTZ19R
• Backbone manufacturer: Fisher Scientific
• Backbone size w/o insert (bp): 2790
• Total vector size (bp): 2959
• Modifications to backbone: The T7 promotor was removed from the pTZ19R vector backbone but included in the vector insert.
• Vector type: in vitro transcription vector

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ARiBo1
• Species: Synthetic
• Insert Size (bp): 169
• Promoter: T7 promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: TCACACAGGAAACAGCTATGACCA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry