Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pluc2-iRFP720
(Plasmid #98887)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98887 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTurbo
  • Backbone manufacturer
    Evrogen
  • Total vector size (bp) 6565
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Firefly Luciferase
  • Alt name
    Luc2
  • Species
    Photinus Pyralis
  • Insert Size (bp)
    1641
  • Promoter CMV
  • Tag / Fusion Protein
    • iRFP720 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer gctagcaatggaagatgccaaaaac
  • 3′ sequencing primer gtcgactgcttgccgcccttcttggcct
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pluc2-iRFP720 was a gift from Laura Mezzanotte (Addgene plasmid # 98887 ; http://n2t.net/addgene:98887 ; RRID:Addgene_98887)
  • For your References section:

    Optimized longitudinal monitoring of stem cell grafts in mouse brain using a novel bioluminescent/near infrared fluorescent fusion reporter. Mezzanotte L, Iljas JD, Que I, Chan A, Kaijzel E, Hoeben R, Lowik C. Cell Transplant. 2017 Apr 26. doi: 10.3727/096368917X695407. 10.3727/096368917X695407 PubMed 28447574