pN-iRS3GG
(Plasmid
#98858)
-
PurposeExpresses pheS cassette (in place of an antisense RNA probe, for golden gate cloning) in E. coli (kanR).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 98858 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCML 521
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsEscherichia coli str. K-12 substr. MG1655 is recommended by the depositor for expression
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePheS cassette to be selectively replaced by unique asRNA probes
-
Insert Size (bp)1087
- Promoter pBAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmbI (not destroyed)
- 3′ cloning site BsmbI (not destroyed)
- 5′ sequencing primer CCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that a 6bp deletion was found during Addgene's quality control which eliminates the XhoI site (CTCGAG). The depositing lab noted there are additional sites present for cloning, and disruption of XhoI does NOT affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pN-iRS3GG was a gift from Lydia Contreras (Addgene plasmid # 98858 ; http://n2t.net/addgene:98858 ; RRID:Addgene_98858) -
For your References section:
Optimization of a novel biophysical model using large scale in vivo antisense hybridization data displays improved prediction capabilities of structurally accessible RNA regions. Vazquez-Anderson J, Mihailovic MK, Baldridge KC, Reyes KG, Haning K, Cho SH, Amador P, Powell WB, Contreras LM. Nucleic Acids Res. 2017 May 19;45(9):5523-5538. doi: 10.1093/nar/gkx115. 10.1093/nar/gkx115 PubMed 28334800