pCML 961
(Plasmid #98848)

• Purpose: pTriFC_aidB. Expresses protein-NYFP and 2MS2BD-5' UTR mStrawberry fusions in E. coli for Dual-fluorescence TriFC assay (ampR).
• Depositing Lab: Lydia Contreras
• Publication: Sowa et al Nucleic Acids Res. 2017 Feb 28;45(4):1673-1686. doi: 10.1093/nar/gkx048.

Backbone

• Vector backbone: Derived from pCML 314
• Backbone size w/o insert (bp): 4200
• Total vector size (bp): 4550
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: 5' UTR + first 100 nucleotides of coding sequence of the aidB gene
• Species: Escherichia coli K-12 MG1655
• Insert Size (bp): 128
• Promoter: pLacO

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: N/A
• 3′ sequencing primer: GGGTTCATTAGATCTGCGCGCG

Gene/Insert 2

• Gene/Insert name: csrA
• Species: Escherichia coli K-12 MG1655
• Insert Size (bp): 183
• Promoter: pLacO

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: N/A
• 3′ sequencing primer: CCGTTTACGTCGCCGTCCAGCTCGACCAGG

Resource Information

• Supplemental Documents:
  • pCML_961.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note- A 3bp deletion in CsrB_Terminator (bps 1423-25 in Genbank file) was found in Addgene's quality control sequence result. The depositing lab has noted this deletion does NOT affect plasmid function.