Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pL2Cas9
(Plasmid #98841)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98841 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTRKL2
  • Backbone size w/o insert (bp) 6419
  • Total vector size (bp) 12221

Growth in Bacteria

  • Bacterial Resistance(s)
    Erythromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB5-alpha
  • Growth instructions
    Growth medium: BHI + Erythromycin 150 µg/ml.
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    tracr/Cas9
  • Insert Size (bp)
    5802

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCATATTAAACTAATTTCGGAGGTC
  • 3′ sequencing primer CTGTATTACTGCATTTATTAAGAGTATTATACC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The original gene was cloned by Luciano Marrafini and received from Addgene #42876.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note from the paper of O'Sullivan, and Klaenhammer: We found that BHI (Difco Laboratories, Detroit, MI, USA) was an excellent selection medium for ErR in E. coli. Unlike LB medium, BHI plates containing 150µg Er/ml afforded a clean selection, with no background colonies appearing even upon prolonged incubaction of one week or more.

O'Sullivan, D.J., T.R. Klaenhammer. 1993. High- and low-copy-number Lactococcus shuttle cloning vectors with features for clone screening. Gene 137:227-231.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pL2Cas9 was a gift from Sylvain Moineau (Addgene plasmid # 98841 ; http://n2t.net/addgene:98841 ; RRID:Addgene_98841)
  • For your References section:

    Genome Engineering of Virulent Lactococcal Phages Using CRISPR-Cas9. Lemay ML, Tremblay DM, Moineau S. ACS Synth Biol. 2017 Mar 30. doi: 10.1021/acssynbio.6b00388. 10.1021/acssynbio.6b00388 PubMed 28324650