Skip to main content
Addgene

pRL_CT_GI_del1
(Plasmid #98744)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98744 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pL1A-lc
  • Backbone size w/o insert (bp) 4300
  • Total vector size (bp) 13000
  • Modifications to backbone
    Additional Leu marker, additional integration cassette for the ura3-52 locus
  • Vector type
    Yeast Expression, Synthetic Biology
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    phytochrome interacting factor 3
  • Alt name
    PIF3
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    1572
  • GenBank ID
    NM_100824
  • Entrez Gene
    PIF3 (a.k.a. AT1G09530, F14J9.19, F14J9_19, PAP3, PHOTOCURRENT 1, PHYTOCHROME INTERACTING FACTOR 3, PHYTOCHROME-ASSOCIATED PROTEIN 3, POC1, phytochrome interacting factor 3, purple acid phosphatase 3)
  • Promoter FBA1
  • Tags / Fusion Proteins
    • SV40-NLS (C terminal on insert)
    • VP64-AD (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TTCCTTCTTCTTCGCCCA
  • 3′ sequencing primer AAGAAAAGAGCCGACCAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    phytochrome B
  • Alt name
    PhyB
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    1863
  • Mutation
    mutated nucleotide 576 C to A, deleted amino acids 622-1172
  • GenBank ID
    NM_001335612
  • Entrez Gene
    PHYB (a.k.a. AT2G18790, HY3, MSF3.17, MSF3_17, OOP1, OUT OF PHASE 1, PHYTOCHROME B, phytochrome B)
  • Promoter TDH3
  • Tag / Fusion Protein
    • synTALE-DBD (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCAATAGCGCATCAAGAAAA
  • 3′ sequencing primer CCCTGAAATTATTCCCCTAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRL_CT_GI_del1 was a gift from Bernd Müller-Röber (Addgene plasmid # 98744 ; http://n2t.net/addgene:98744 ; RRID:Addgene_98744)
  • For your References section:

    PhiReX: a programmable and red light-regulated protein expression switch for yeast. Hochrein L, Machens F, Messerschmidt K, Mueller-Roeber B. Nucleic Acids Res. 2017 Sep 6;45(15):9193-9205. doi: 10.1093/nar/gkx610. 10.1093/nar/gkx610 PubMed 28911120