pCX-H2B-KikGR
(Plasmid
#98649)
-
PurposeExpresses a nuclear-localized photoconvertible green-to-red fluorescent protein
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 98649 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 4880
- Total vector size (bp) 5880
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKikGR
-
Specieshumanized from stony coral (Favia favus)
-
Insert Size (bp)1000
-
GenBank IDAB 193293
- Promoter CMV-IE enhancer chick beta actin promoter
-
Tag
/ Fusion Protein
- H2B (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (not unique) (not destroyed)
- 3′ cloning site EcoR1 (not unique) (not destroyed)
- 5′ sequencing primer atgccagagccagcgaagtctgctcccgcc
- 3′ sequencing primer CTTGGCCAGCCTGGGCAGGCCGCTGTGGGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMBL Amakgaam (AM-V0084)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCX-H2B-KikGR was a gift from Anna-Katerina Hadjantonakis (Addgene plasmid # 98649 ; http://n2t.net/addgene:98649 ; RRID:Addgene_98649) -
For your References section:
Use of KikGR a photoconvertible green-to-red fluorescent protein for cell labeling and lineage analysis in ES cells and mouse embryos. Nowotschin S, Hadjantonakis AK. BMC Dev Biol. 2009 Sep 9;9:49. 10.1186/1471-213X-9-49 PubMed 19740427
Map uploaded by the depositor.