Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCX-H2B-KikGR
(Plasmid #98649)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98649 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCAGGS
  • Backbone size w/o insert (bp) 4880
  • Total vector size (bp) 5880
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KikGR
  • Species
    humanized from stony coral (Favia favus)
  • Insert Size (bp)
    1000
  • GenBank ID
    AB 193293
  • Promoter CMV-IE enhancer chick beta actin promoter
  • Tag / Fusion Protein
    • H2B (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho1 (not unique) (not destroyed)
  • 3′ cloning site EcoR1 (not unique) (not destroyed)
  • 5′ sequencing primer atgccagagccagcgaagtctgctcccgcc
  • 3′ sequencing primer CTTGGCCAGCCTGGGCAGGCCGCTGTGGGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    MBL Amakgaam (AM-V0084)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCX-H2B-KikGR was a gift from Anna-Katerina Hadjantonakis (Addgene plasmid # 98649 ; http://n2t.net/addgene:98649 ; RRID:Addgene_98649)
  • For your References section:

    Use of KikGR a photoconvertible green-to-red fluorescent protein for cell labeling and lineage analysis in ES cells and mouse embryos. Nowotschin S, Hadjantonakis AK. BMC Dev Biol. 2009 Sep 9;9:49. 10.1186/1471-213X-9-49 PubMed 19740427