p46Cpf1-OP2
(Plasmid #98592)

• Purpose: Produces lambda Red and Cpf1 for recombination and selection. The plasmid is combined with a donor plasmid (with crRNA and template) for rapid genome editing in E.coli.
• Depositing Lab: Qiong Wu
• Publication: Ao et al Front Microbiol. 2018 Oct 9;9:2307. doi: 10.3389/fmicb.2018.02307. eCollection 2018.

Backbone

• Vector backbone: pKD46
• Backbone manufacturer: Datsenko KA & Wanner BL (PMID:10829079)
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: FnCpf1
• Species: Francisella
• Mutation: Codon optimized for E. coli
• Promoter: araBAD

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: pBAD-F (ATGCCATAGCATTTTTATCC)
• 3′ sequencing primer: rrnB-T1-term-Rev (GAAAGGCCCAGTCTTTCGAC)

Resource Information

• Supplemental Documents:
  • p46Cpf1-OP2.gbk
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry