HCB1
(Plasmid #98582)

• Purpose: Huntingtin Chromobody 1: "Happ1" intrabody recognizing amino acids 41–81 of huntingtin, fused to eYFP.
• Depositing Lab: Ray Truant
• Publication: Maiuri et al Hum Mol Genet. 2016 Dec 25. pii: ddw395. doi: 10.1093/hmg/ddw395.

Backbone

• Vector backbone: peYFPN1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 5074
• Modifications to backbone: Bears the peYFPC1 multiple cloning site
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HCB1
• Alt name: Happ1
• Species: Synthetic
• Insert Size (bp): 374
• Promoter: CMV
• Tag / Fusion Protein:
  • YFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BspEI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GTGTACGGTGGGAGGTC
• 3′ sequencing primer: GTAAAACCTCTACAAATGTG

Resource Information

• Supplemental Documents:
  • HCB construct generation
• A portion of this plasmid was derived from a plasmid made by: SOUTHWELL, A. L., KHOSHNAN, A., DUNN, D. E., BUGG, C. W., LO, D. C. & PATTERSON, P. H. 2008. Intrabodies binding the proline-rich domains of mutant huntingtin increase its turnover and reduce neurotoxicity. J Neurosci, 28, 9013-20.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry