nucHCB2
(Plasmid #98581)

• Purpose: Nuclear Huntingtin Chromobody 2: "iVHH4" intrabody recognizing amino acids 49–148 of huntingtin, fused to eYFP and nuclear localization signal.
• Depositing Lab: Ray Truant
• Publication: Maiuri et al Hum Mol Genet. 2016 Dec 25. pii: ddw395. doi: 10.1093/hmg/ddw395.

Backbone

• Vector backbone: peYFPN1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4700
• Total vector size (bp): 5116
• Modifications to backbone: Bears the peYFPC1 multiple cloning site
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HCB2
• Alt name: iVHH4
• Species: Synthetic
• Insert Size (bp): 386
• Promoter: CMV
• Tags / Fusion Proteins:
  • YFP (C terminal on insert)
  • NLS (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTGTACGGTGGGAGGTC
• 3′ sequencing primer: GTAAAACCTCTACAAATGTG

Resource Information

• Supplemental Documents:
  • HCB construct generation
• A portion of this plasmid was derived from a plasmid made by: SCHUT, M. H., PEPERS, B. A., KLOOSTER, R., VAN DER MAAREL, S. M., EL KHATABI, M., VERRIPS, T., DEN DUNNEN, J. T., VAN OMMEN, G. J. & VAN ROON-MOM, W. M. 2015. Selection and characterization of llama single domain antibodies against N-terminal huntingtin. Neurol Sci, 36, 429-34.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry