Skip to main content
Addgene

nucHCB2
(Plasmid #98581)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98581 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    peYFPN1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5116
  • Modifications to backbone
    Bears the peYFPC1 multiple cloning site
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HCB2
  • Alt name
    iVHH4
  • Species
    Synthetic
  • Insert Size (bp)
    386
  • Promoter CMV
  • Tags / Fusion Proteins
    • YFP (C terminal on insert)
    • NLS (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTGTACGGTGGGAGGTC
  • 3′ sequencing primer GTAAAACCTCTACAAATGTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    SCHUT, M. H., PEPERS, B. A., KLOOSTER, R., VAN DER MAAREL, S. M., EL KHATABI, M., VERRIPS, T., DEN DUNNEN, J. T., VAN OMMEN, G. J. & VAN ROON-MOM, W. M. 2015. Selection and characterization of llama single domain antibodies against N-terminal huntingtin. Neurol Sci, 36, 429-34.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    nucHCB2 was a gift from Ray Truant (Addgene plasmid # 98581 ; http://n2t.net/addgene:98581 ; RRID:Addgene_98581)
  • For your References section:

    Huntingtin is a scaffolding protein in the ATM oxidative DNA damage response complex. Maiuri T, Mocle AJ, Hung CL, Xia J, van Roon-Mom WM, Truant R. Hum Mol Genet. 2016 Dec 25. pii: ddw395. doi: 10.1093/hmg/ddw395. 10.1093/hmg/ddw395 PubMed 28017939