pRSETa-mEos4b-V69T
(Plasmid #98572)

• Purpose: photoconvertible fluorescent protein mEos4b-V69T in pRSetA plasmid, photoconvertible by primed conversion mechanism, bacterial overexpression
• Depositing Lab: Ulrike Endesfelder
• Publication: Turkowyd et al Angew Chem Int Ed Engl. 2017 Jun 2. doi: 10.1002/anie.201702870.

Backbone

• Vector backbone: pRsetA
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mEos4b-V69T
• Promoter: T7
• Tag / Fusion Protein:
  • 6xHis (N terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: T7 term (GCTAGTTATTGCTCAGCGG)
• 3′ sequencing primer: T7 (TAATACGACTCACTATAGGG)

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pRSETa_ mEos4b (Plasmid #51073)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

mEos4b-V69T is named and aligned in reference to the Dendra2 fluorescent protein sequence. The mutation in the mEos4b reference is at position 70. However, to avoid confusion, we named this protein in alignment with Dendra2 (see Fig. S1a, 10.1002/anie.201702870).