MAP1LC3A-V1
(Plasmid
#98569)
-
PurposeExpresses MAP1LC3A-V1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 98569 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepIRES2-AcGFP
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 5300
- Total vector size (bp) 5966
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMAP1LC3A
-
Alt nameLC3A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)366
-
GenBank IDNM_032514
-
Entrez GeneMAP1LC3A (a.k.a. ATG8E, LC3, LC3A, MAP1ALC3, MAP1BLC3)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AAAAAGAATTCATGCCCTCAGACCGGCC
- 3′ sequencing primer AAAAAGGATCCTCAGAAGCCGAAGGTTTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MAP1LC3A-V1 was a gift from Shahenda El-Naggar (Addgene plasmid # 98569 ; http://n2t.net/addgene:98569 ; RRID:Addgene_98569) -
For your References section:
LC3A Silencing Hinders Aggresome Vimentin Cage Clearance in Primary Choroid Plexus Carcinoma. Nassar M, Samaha H, Ghabriel M, Yehia M, Taha H, Salem S, Shaaban K, Omar M, Ahmed N, El-Naggar S. Sci Rep. 2017 Aug 14;7(1):8022. doi: 10.1038/s41598-017-07403-5. 10.1038/s41598-017-07403-5 [pii] PubMed 28808307