DHL708
(Bacterial strain
#98417)
-
PurposeBacterial Strain with Genotype: MC4100 ∆clpPX
-
Depositing Lab
-
Sequence Information
-
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Bacterial Strain | 98417 | Bacteria in agar stab | 1 | $85 |
Backbone
-
Vector backbonenone
Growth in Bacteria
-
Bacterial Resistance(s)Streptomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DHL708
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGenotype: MC4100 ∆clpPX
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Strain DHL708 was built by deleting the clpPX operon with lambda-Red mediated homologous recombination. The FRT-flanked Kan cassette was then flipped out using the FLP recombinase (pCP20).
The deletion region can be PCR-amplified and sequenced using the primers CCGCTCGAGTTTACGCAGCATAACGCGCTAAATTC and CGTCAGTATATGGGGATGTTTCCCC.
Originally described in Landgraf, D., Okumus, B., Chien, P., Baker, T. A. & Paulsson, J. Segregation of molecules at cell division reveals native protein localization. Nat Methods 9, 480–482 (2012).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DHL708 was a gift from Johan Paulsson (Addgene plasmid # 98417) -
For your References section:
Synchronous long-term oscillations in a synthetic gene circuit. Potvin-Trottier L, Lord ND, Vinnicombe G, Paulsson J. Nature. 2016 Oct 12;538(7626):514-517. doi: 10.1038/nature19841. 10.1038/nature19841 PubMed 27732583