DHL708
(Bacterial strain #98417)

• Purpose: Bacterial Strain with Genotype: MC4100 ∆clpPX
• Depositing Lab: Johan Paulsson
• Publication: Potvin-Trottier et al Nature. 2016 Oct 12;538(7626):514-517. doi: 10.1038/nature19841.

Backbone

• Vector backbone: none

Growth in Bacteria

• Bacterial Resistance(s): Streptomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DHL708
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Genotype: MC4100 ∆clpPX

Resource Information

• Supplemental Documents:
  • Strain 98417 Verification Protocol

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Strain DHL708 was built by deleting the clpPX operon with lambda-Red mediated homologous recombination. The FRT-flanked Kan cassette was then flipped out using the FLP recombinase (pCP20).

The deletion region can be PCR-amplified and sequenced using the primers CCGCTCGAGTTTACGCAGCATAACGCGCTAAATTC and CGTCAGTATATGGGGATGTTTCCCC.

Originally described in Landgraf, D., Okumus, B., Chien, P., Baker, T. A. & Paulsson, J. Segregation of molecules at cell division reveals native protein localization. Nat Methods 9, 480–482 (2012).