Skip to main content
Addgene

SLC25A1_pLX307
(Plasmid #98374)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98374 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLX307
  • Backbone manufacturer
    David Root (Addgene plasmid # 41392)
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SLC25A1
  • Species
    H. sapiens (human)
  • Entrez Gene
    SLC25A1 (a.k.a. CIC, CMS23, CTP, D2L2AD, SEA, SLC20A3)
  • Promoter E1Fa
  • Tag / Fusion Protein
    • V5 (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TTCTTCCATTTCAGGTGTCGTGAG
  • 3′ sequencing primer GTGGATACGCTGCTTTAATGCCTT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SLC25A1_pLX307 was a gift from William Hahn & Sefi Rosenbluh (Addgene plasmid # 98374 ; http://n2t.net/addgene:98374 ; RRID:Addgene_98374)
  • For your References section:

    Genetic and Proteomic Interrogation of Lower Confidence Candidate Genes Reveals Signaling Networks in beta-Catenin-Active Cancers. Rosenbluh J, Mercer J, Shrestha Y, Oliver R, Tamayo P, Doench JG, Tirosh I, Piccioni F, Hartenian E, Horn H, Fagbami L, Root DE, Jaffe J, Lage K, Boehm JS, Hahn WC. Cell Syst. 2016 Sep 28;3(3):302-316.e4. doi: 10.1016/j.cels.2016.09.001. 10.1016/j.cels.2016.09.001 PubMed 27684187