RNF6_pLX307
(Plasmid
#98366)
-
PurposeLentiviral expression of RNF6
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 98366 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLX307
-
Backbone manufacturerDavid Root (Addgene plasmid # 41392)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRNF6
-
SpeciesH. sapiens (human)
-
Entrez GeneRNF6
- Promoter E1Fa
-
Tag
/ Fusion Protein
- V5 (C terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TTCTTCCATTTCAGGTGTCGTGAG
- 3′ sequencing primer GTGGATACGCTGCTTTAATGCCTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RNF6_pLX307 was a gift from William Hahn & Sefi Rosenbluh (Addgene plasmid # 98366 ; http://n2t.net/addgene:98366 ; RRID:Addgene_98366) -
For your References section:
Genetic and Proteomic Interrogation of Lower Confidence Candidate Genes Reveals Signaling Networks in beta-Catenin-Active Cancers. Rosenbluh J, Mercer J, Shrestha Y, Oliver R, Tamayo P, Doench JG, Tirosh I, Piccioni F, Hartenian E, Horn H, Fagbami L, Root DE, Jaffe J, Lage K, Boehm JS, Hahn WC. Cell Syst. 2016 Sep 28;3(3):302-316.e4. doi: 10.1016/j.cels.2016.09.001. 10.1016/j.cels.2016.09.001 PubMed 27684187