Skip to main content
Addgene

lentiCRISPRv2 puro
(Plasmid #98290)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98290 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart
Cloning Grade DNA 98290-DNA.cg 2 µg of cloning grade DNA in Tris buffer 1 $105
Add to Cart

Backbone

  • Vector backbone
    lentiCRISPRv2
  • Backbone manufacturer
    Feng Zhang (Addgene #52961)
  • Backbone size (bp) 14877
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    P2A-puro
  • Promoter EF-1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer CCAAAGAGGTGCTGGACG
  • 3′ sequencing primer WPRE-R (CATAGCGTAAAAGGAGCAACA)
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

P2A-antibiotic resistance gene cassettes from the plasmids in this deposit (https://www.addgene.org/depositing/74286/) can be cloned in place of the P2A-puro gene using the unique BamHI and MluI sites. The second MluI site in the original lentiCRISPRv2 plasmid was destroyed by Klenow end-filling and religation after MluI digestion. For target guide (sgRNA) sequence cloning instructions, please see https://www.addgene.org/52961 for the Zhang's lab lentiCRISPR v2 guide.

Information for Cloning Grade DNA (Catalog # 98290-DNA.cg) ( Back to top)

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $105 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lentiCRISPRv2 puro was a gift from Brett Stringer (Addgene plasmid # 98290 ; http://n2t.net/addgene:98290 ; RRID:Addgene_98290)

  • For your References section:

    A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma. Stringer BW, Day BW, D'Souza RCJ, Jamieson PR, Ensbey KS, Bruce ZC, Lim YC, Goasdoue K, Offenhauser C, Akgul S, Allan S, Robertson T, Lucas P, Tollesson G, Campbell S, Winter C, Do H, Dobrovic A, Inglis PL, Jeffree RL, Johns TG, Boyd AW. Sci Rep. 2019 Mar 20;9(1):4902. doi: 10.1038/s41598-019-41277-z. 10.1038/s41598-019-41277-z PubMed 30894629
Related items:
Commonly requested with: