pmEos2-Linker_PCNA-MutC
(Plasmid #98272)

• Purpose: for low level expression of mEos2-PCNA in mammalian cells
• Depositing Lab: Mike Heilemann
• Publication: Zessin et al Sci Rep. 2016 Jan 13;6:18779. doi: 10.1038/srep18779.

Backbone

• Vector backbone: C2
• Backbone manufacturer: Clontech
• Vector type: Mammalian Expression
• Selectable markers: mEos2

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PCNA
• Species: H. sapiens (human)
• Insert Size (bp): 782
• Mutation: Silent mutated Sequence: GACGCCGTAGTTATATCTTGC (Original: GATGCTGTTGTAATTTCCTGT)
• Entrez Gene: PCNA (a.k.a. ATLD2)
• Promoter: CMV
• Tag / Fusion Protein:
  • mEos2 (N terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: CMV-F

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid encodes a second insert: mEos2 (from Lobophyllia hemprichii). A glycine-rich linker sequence (GEGQGQGQGPGRGYAYRS), which was reported to be necessary for cell line generation, was inserted as a spacer between mEos2 and PCNA.