Skip to main content
Addgene

AAV2_hSyn_Aurora_Citrine
(Plasmid #98217)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98217 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV2
  • Backbone size w/o insert (bp) 5315
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Synthetic construct Aurora gene
  • Alt name
    Aurora
  • Alt name
    ReaChR, bReachEs
  • Species
    Synthetic; Chlamydomonas reinhardtii, Volvox carteri
  • Insert Size (bp)
    915
  • Mutation
    V59S, E83N, E90Q, E101S, V117R, E123S, P242R, A246N, N258Q, E273S
  • Promoter human synapsin
  • Tag / Fusion Protein
    • Citrine (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
  • 3′ sequencing primer TGAACAGCTCCTCGCCCTTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2017/06/27/156422 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV2_hSyn_Aurora_Citrine was a gift from Simon Wiegert (Addgene plasmid # 98217 ; http://n2t.net/addgene:98217 ; RRID:Addgene_98217)
  • For your References section:

    Anion-conducting channelrhodopsins with tuned spectra and modified kinetics engineered for optogenetic manipulation of behavior. Wietek J, Rodriguez-Rozada S, Tutas J, Tenedini F, Grimm C, Oertner TG, Soba P, Hegemann P, Wiegert JS. Sci Rep. 2017 Nov 2;7(1):14957. doi: 10.1038/s41598-017-14330-y. 10.1038/s41598-017-14330-y [pii] PubMed 29097684