AAV2_hSyn_Aurora_Citrine
(Plasmid #98217)

• Purpose: Red-shifted artificial anion conducting channelrhodopsin (aACR). Activation up to 600 nm; off-kinetics 260 ms. Codon optimized for mammalian expression.
• Depositing Lab: Simon Wiegert
• Publication: Wietek et al Sci Rep. 2017 Nov 2;7(1):14957. doi: 10.1038/s41598-017-14330-y.

Backbone

• Vector backbone: pAAV2
• Backbone size w/o insert (bp): 5315
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Synthetic construct Aurora gene
• Alt name: Aurora
• Alt name: ReaChR, bReachEs
• Species: Synthetic; Chlamydomonas reinhardtii, Volvox carteri
• Insert Size (bp): 915
• Mutation: V59S, E83N, E90Q, E101S, V117R, E123S, P242R, A246N, N258Q, E273S
• Promoter: human synapsin
• Tag / Fusion Protein:
  • Citrine (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GACTCAGCGCTGCCTCAGTCTG
• 3′ sequencing primer: TGAACAGCTCCTCGCCCTTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2017/06/27/156422 for bioRxiv preprint.