AAV2_hSyn_Phobos_Citrine
(Plasmid #98216)

• Purpose: Blue-shifted artificial anion conducting channelrhodopsin (aACR). Activation max 466 nm; off-kinetics 10 ms. Codon optimized for mammalian expression.
• Depositing Lab: Simon Wiegert
• Publication: Wietek et al Sci Rep. 2017 Nov 2;7(1):14957. doi: 10.1038/s41598-017-14330-y.

Backbone

• Vector backbone: pAAV2
• Backbone size w/o insert (bp): 5303
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Synthetic construct Phobos gene
• Alt name: Phobos
• Alt name: iC++
• Species: Synthetic; Chlamydomonas reinhardtii
• Insert Size (bp): 927
• Mutation: T59S, E83N, E90Q, E101S, V117R, E123S, T159G, G163A, V242R, T246N, N258Q, E273S
• Promoter: human synapsin
• Tag / Fusion Protein:
  • Citrine (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: GACTCAGCGCTGCCTCAGTCTG
• 3′ sequencing primer: TGAACAGCTCCTCGCCCTTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/early/2017/06/27/156422 for bioRxiv preprint.