Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBa-LSS-GFP-LDLR wt
(Plasmid #98184)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98184 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBa-eGFP
  • Backbone size w/o insert (bp) 6755
  • Total vector size (bp) 9335
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LDLR
  • Alt name
    human low density lipoprotein receptor
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3326
  • Mutation
    none
  • GenBank ID
    NM_000527
  • Entrez Gene
    LDLR (a.k.a. FH, FHC, FHCL1, LDLCQ2)
  • Promoter Chicken Beta Actin
  • Tags / Fusion Proteins
    • GFP (N terminal on insert)
    • LDLR signal sequence, N-term of GFP so GFP remains on mature protein when ss is cleaved (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII-vector, NheI-insert (destroyed during cloning)
  • 3′ cloning site RsrII (not destroyed)
  • 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
  • 3′ sequencing primer GATGAGTTTGGACAAACCAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBa-LSS-GFP-LDLR wt was a gift from Gary Banker & Marvin Bentley (Addgene plasmid # 98184 ; http://n2t.net/addgene:98184 ; RRID:Addgene_98184)
  • For your References section:

    A novel split kinesin assay identifies motor proteins that interact with distinct vesicle populations. Jenkins B, Decker H, Bentley M, Luisi J, Banker G. J Cell Biol. 2012 Aug 20;198(4):749-61. doi: 10.1083/jcb.201205070. 10.1083/jcb.201205070 PubMed 22908316