-
PurposePurification of Cas9 protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 98158 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28a (+)
-
Backbone manufacturerEMD Biosciences
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNLS-Cas9-NLS
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer T7 (TAATACGACTCACTATAGGG) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-Cas9-His was a gift from Caixia Gao (Addgene plasmid # 98158 ; http://n2t.net/addgene:98158 ; RRID:Addgene_98158) -
For your References section:
Efficient DNA-free genome editing of bread wheat using CRISPR/Cas9 ribonucleoprotein complexes. Liang Z, Chen K, Li T, Zhang Y, Wang Y, Zhao Q, Liu J, Zhang H, Liu C, Ran Y, Gao C. Nat Commun. 2017 Jan 18;8:14261. doi: 10.1038/ncomms14261. 10.1038/ncomms14261 PubMed 28098143