Skip to main content
Addgene

hIRF-1 gRNA #409 (Sa)
(Plasmid #98134)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 98134 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    BPK2660
  • Backbone manufacturer
    Keith Joung (Addgene plasmid #70709)
  • Backbone size w/o insert (bp) 2288
  • Total vector size (bp) 2287
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA_hIRF1 promoter #409
  • gRNA/shRNA sequence
    tctccagtgggaacactggg
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    555
  • GenBank ID
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmB I (destroyed during cloning)
  • 3′ cloning site BsmB I (destroyed during cloning)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Keith Joung (Addgene plasmid 70709)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hIRF-1 gRNA #409 (Sa) was a gift from Hodaka Fujii (Addgene plasmid # 98134 ; http://n2t.net/addgene:98134 ; RRID:Addgene_98134)
  • For your References section:

    enChIP systems using different CRISPR orthologues and epitope tags. Fujita T, Yuno M, Fujii H. BMC Res Notes. 2018 Feb 27;11(1):154. doi: 10.1186/s13104-018-3262-4. 10.1186/s13104-018-3262-4 PubMed 29482606