hIRF-1 gRNA #409 (Sa)
(Plasmid #98134)

• Purpose: Expresses a guide RNA (gRNA) to target human IRF-1 promoter for the Sa-Cas9 system
• Depositing Lab: Hodaka Fujii
• Publication: Fujita et al BMC Res Notes. 2018 Feb 27;11(1):154. doi: 10.1186/s13104-018-3262-4.

Backbone

• Vector backbone: BPK2660
• Backbone manufacturer: Keith Joung (Addgene plasmid #70709)
• Backbone size w/o insert (bp): 2288
• Total vector size (bp): 2287
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: gRNA_hIRF1 promoter #409
• gRNA/shRNA sequence: tctccagtgggaacactggg
• Species: H. sapiens (human)
• Insert Size (bp): 555
• GenBank ID:
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmB I (destroyed during cloning)
• 3′ cloning site: BsmB I (destroyed during cloning)
• 5′ sequencing primer: LKO.1 5'

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Keith Joung (Addgene plasmid 70709)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry