CMYA5tnC/pENTR3C
(Plasmid
#98128)
-
PurposeCMYA5 (NM_153610, nt 11648 to 12279) in pENTR3C, Gateway Entry vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 98128 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Login to view industry pricing.
Backbone
-
Vector backbonepENTR3C
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2723
- Total vector size (bp) 2881
-
Modifications to backboneccdB gene is placed
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCMYA5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)642
-
GenBank IDNM_153610
-
Entrez GeneCMYA5 (a.k.a. C5orf10, SPRYD2, TRIM76)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAAGCAGAAGGCCATCCTG
- 3′ sequencing primer GTAACATCAGAGATTTTGAGACAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMYA5tnC/pENTR3C was a gift from Rita Shiang (Addgene plasmid # 98128 ; http://n2t.net/addgene:98128 ; RRID:Addgene_98128)