Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

nucHCB1
(Plasmid #97424)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 97424 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    peYFPN1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5104
  • Modifications to backbone
    Bears the peYFPC1 multiple cloning site
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nucHCB1
  • Alt name
    Happ1
  • Species
    Synthetic
  • Insert Size (bp)
    374
  • Promoter CMV
  • Tags / Fusion Proteins
    • YFP (C terminal on insert)
    • NLS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BspEI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GTGTACGGTGGGAGGTC
  • 3′ sequencing primer GTAAAACCTCTACAAATGTG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    SOUTHWELL, A. L., KHOSHNAN, A., DUNN, D. E., BUGG, C. W., LO, D. C. & PATTERSON, P. H. 2008. Intrabodies binding the proline-rich domains of mutant huntingtin increase its turnover and reduce neurotoxicity. J Neurosci, 28, 9013-20.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    nucHCB1 was a gift from Ray Truant (Addgene plasmid # 97424 ; http://n2t.net/addgene:97424 ; RRID:Addgene_97424)
  • For your References section:

    Huntingtin is a scaffolding protein in the ATM oxidative DNA damage response complex. Maiuri T, Mocle AJ, Hung CL, Xia J, van Roon-Mom WM, Truant R. Hum Mol Genet. 2016 Dec 25. pii: ddw395. doi: 10.1093/hmg/ddw395. 10.1093/hmg/ddw395 PubMed 28017939