AAV_Actb NHEJ donor
(Plasmid
#97316)
-
PurposeNHEJ donor for fusing a p2A-mCherry reporter to mouse Actb.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 97316 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, Mouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameActb NHEJ donor
-
Alt nameActb NHEJ template
-
SpeciesSynthetic
-
Insert Size (bp)815
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer M13R
- 3′ sequencing primer M13F (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA sequence: agtccgcctagaagcacttg
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV_Actb NHEJ donor was a gift from Hui Yang (Addgene plasmid # 97316 ; http://n2t.net/addgene:97316 ; RRID:Addgene_97316) -
For your References section:
Homology-mediated end joining-based targeted integration using CRISPR/Cas9. Yao X, Wang X, Hu X, Liu Z, Liu J, Zhou H, Shen X, Wei Y, Huang Z, Ying W, Wang Y, Nie YH, Zhang CC, Li S, Cheng L, Wang Q, Wu Y, Huang P, Sun Q, Shi L, Yang H. Cell Res. 2017 May 19. doi: 10.1038/cr.2017.76. 10.1038/cr.2017.76 PubMed 28524166